subject
Biology, 07.06.2021 21:40 nida7864

What are the four primary uses or benefits of the nguni breed amongst South African communities?​

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 17:40
What links the two strands in a dna helix together in the middle? a. phosphate groups b. sugar rings bonded together c. proteins d. bases with hydrogen bonds
Answers: 1
question
Biology, 21.06.2019 18:30
This aquarium exhibits biotic and abiotic factors in an aquatic environment. one of the abiotic factors is
Answers: 3
question
Biology, 22.06.2019 00:40
Which would best keep the oxygen cycle stable? a. cutting down jungles to create farmland b. eliminating parks in large cities c. dumping toxic chemicals into the ocean d. reducing the amount of deforestation d. reducing the amount of deforestation
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What are the four primary uses or benefits of the nguni breed amongst South African communities?​...
Questions
question
Biology, 16.09.2019 23:00
Questions on the website: 13722361