Biology, 09.06.2021 04:00 jalenyork6835
Hormones are proteins that act as chemical-signaling molecules in the body. Each hormone plays a unique role in regulating processes such as growth, development, and reproduction. The diagram shows the hormones oxytocin and vasopressin.
The amino acid sequence of Oxytocin consists of six amino acids connected in sequence, in the shape of a hexagon: T-y-r, I-l-e, G-l-n, A-s-n, C-y-s, and C-y-s. Attached to one of the C-y-s amino acids is a chain of three amino acids: P-r-o, L-e-u, G-l-y. The amino acid sequence of Vasopressin consists of six amino acids connected in sequence, in the shape of a hexagon: T-y-r, P-h-e, G-l-n, A-s-n, C-y-s, and C-y-s. Attached to one of the C-y-s amino acids is a chain of three amino acids: P-r-o, A-r-g, G-l-y.
Using the diagram, which THREE sentences correctly describe the hormones?
A
The hormones perform the same function.
B
The hormones perform different functions.
C
The hormones have the same amino acids.
D
The hormones have two unique amino acids.
E
The hormones have the same number of amino acids.
F
The hormones have the same sequence of amino acids.
Answers: 2
Biology, 21.06.2019 17:50
How did the research presented in the article affect scientists' understanding of the evolution of eukaryotes
Answers: 3
Biology, 21.06.2019 22:30
Which statement about dna replication is true? a. eukaryotes only have one circular chromosome that unwinds at multiple locations. b. eukaryotes can only replicate one segment of a chromosome at a time. c. prokaryotes can only replicate their single circular chromosome in the nucleus. d. prokaryotes only have one origin of replication to initiate replication.
Answers: 2
Biology, 22.06.2019 01:30
Based on the law of dominance, we would expect percent of the offspring from this cross to have large teeth.
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Hormones are proteins that act as chemical-signaling molecules in the body. Each hormone plays a uni...
English, 19.12.2020 01:00
Mathematics, 19.12.2020 01:00
English, 19.12.2020 01:00
Computers and Technology, 19.12.2020 01:00
English, 19.12.2020 01:00
Mathematics, 19.12.2020 01:00
English, 19.12.2020 01:00
Mathematics, 19.12.2020 01:00
English, 19.12.2020 01:00
Mathematics, 19.12.2020 01:00
Mathematics, 19.12.2020 01:00
Social Studies, 19.12.2020 01:00