Biology, 10.06.2021 02:40 ralph08123
Which of the following is an accurate comparison of the light-dependent and light-independent reactions of photosynthesis?
A. The light-dependent reactions consume H20 C02; the light-independent reactions produce H20 and C02.
B. The light-dependent reactions produce ATP and NADPH; the light-independent reactions use stored energy in ATP and NADPH.
C. The light-dependent reactions occur during the day and night; the light-independent reactions only occur at night.
D. The light-dependent reactions occur in the cytoplasm; the light-independent reactions occur in the chloroplasts.
Answers: 3
Biology, 21.06.2019 22:00
Explain why phospholipid molecules form a bilayer. (3 marks)
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:20
First idea: suddenly, women were leaving their homes to cycle and socialize on country roads and city streets. —wheels of change, sue macy second idea: it was not a stretch for some cyclists to see the possibility of a larger role for women in the world. —wheels of change, sue macy what type of graphic organizer would best represent the connection between these two ideas? 1) a t-chart that separates ideas into two different categories 2) a chronology that shows 3) a sequence of several events a cause-and-effect graphic that shows how one idea led to another 4)a problem-solution graphic that presents a problem and a solution to the problem
Answers: 2
Which of the following is an accurate comparison of the light-dependent and light-independent reacti...
Mathematics, 13.03.2022 20:40
Physics, 13.03.2022 20:40
Mathematics, 13.03.2022 20:40
Mathematics, 13.03.2022 20:40
Computers and Technology, 13.03.2022 20:40
Mathematics, 13.03.2022 20:40
Mathematics, 13.03.2022 20:40
English, 13.03.2022 20:40
English, 13.03.2022 20:40
Chemistry, 13.03.2022 20:50
Mathematics, 13.03.2022 20:50
Social Studies, 13.03.2022 20:50
Mathematics, 13.03.2022 20:50