Biology, 28.06.2021 02:50 Treshard

What are the three outcomes of C3a and C3b?

Answers: 3

Show answers

Answers

Answer from: austinwst3

Complement

Leave the first rating

STUDY

Play

The Complement System: Overview

Tap card to see the definition

Major component of Innate Immune System

Consists of over 30 proteins, which participate in a tightly regulated cascade-like activation process.

Protects host from pathogenic microorganims, contributes to immune complex regulation & is an important link between the innate & adaptive immune systems.

Tap again to see the term

3 Major Outcomes of Complement Activation

Tap card to see the definition

1. Stimulation of inflammatory reactions via release proinflammatory mediators, which induce chemotaxis of leukocytes (leading to microbe destruction) & inflammation

2. Opsonization of pathogens by depositing fragments of complement proteins on the pathogens, making them more susceptible to phagocytosis

3. Complement-Mediated Cytolysis, via formation of a Membrane Attack Complex, which can insert itself into bacterial membrane & cause osmotic lysis

Tap again to see the term

1/67

Profile Picture

Created by

Patch2257

Tags related to this set

Alternative Pathway Steps

Lectin Pathway Activation

Classical Pathway Activation

Terms in this set (67)

The Complement System: Overview

Major component of Innate Immune System

Consists of over 30 proteins, which participate in a tightly regulated cascade-like activation process.

Protects host from pathogenic microorganims, contributes to immune complex regulation & is an important link between the innate & adaptive immune systems.

3 Major Outcomes of Complement Activation

1. Stimulation of inflammatory reactions via release proinflammatory mediators, which induce chemotaxis of leukocytes (leading to microbe destruction) & inflammation

2. Opsonization of pathogens by depositing fragments of complement proteins on the pathogens, making them more susceptible to phagocytosis

3. Complement-Mediated Cytolysis, via formation of a Membrane Attack Complex, which can insert itself into bacterial membrane & cause osmotic lysis

Explanation:

i don't know if It helps you...parang Ang layo naman Ng sagot ko sa tanong mo

Answer from: Quest

ur answer is e & d

explanation:

This image shows a volcanic eruption in hawaii with lava flowing into the sea. which statements best

Answer from: Quest

1. the energy lost to disorder metabolism -entropy

2. related to or possessing motion potential -kinetic

3. all of the chemical reactions in an organism required for maintenance of the processes of life entropy -metabolism

4. possible; ability to go into action or perform work kinetic -potential

5. the study of energy and its transformations thermodynamics -thermodynamics

Another question on Biology

Biology, 22.06.2019 10:00

14. which of the following codons code for threonine? a. ucg b. ugu c. cga d. aca

Answers: 2

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

Biology, 22.06.2019 12:10

Recombinant dna is the merging of dna from unrelated organisms to create new genetic varieties is assembled in the lab from mononucleotides was part of the green revolution of the 1960s is pollination of one plant by another of the same species is cross-pollination of one plant by a different species

Answers: 1

Answer

Biology, 22.06.2019 13:40

1. -define adaptation2 explain darwin's theories of descent with modification and natural selection in detail3. -explain how each of these provides evidence for evolution: a. -fossil record, including superposition and transitional fossilsb-anatomy, including homologous structuresc-biological molecules, including dna and proteins4. -explain the difference between convergent and divergent evolution.5. -define and give three examples of artificial selection6. -define and give one example of coevolution.7. -explain biodiversity and how it benefits humans.8. -explain a type of population lest affected by environmental change.