![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:30
In pea plants, the allele for inflated pod seed, i, is dominant over the allele for constricted pod seed, i. the punnett square shows a cross for this trait. which offspring will be homozygous dominant
Answers: 2
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:00
What advantages does a pedigree have over a written passage?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Which way do the chlorophyll bands move on the chromatography paper?...
Questions
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/fizika.png)
Physics, 10.02.2020 17:14
![question](/tpl/images/cats/biologiya.png)
Biology, 10.02.2020 17:14
![question](/tpl/images/cats/istoriya.png)
History, 10.02.2020 17:14
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/fizika.png)
Physics, 10.02.2020 17:14
![question](/tpl/images/cats/mat.png)
Mathematics, 10.02.2020 17:15
![question](/tpl/images/cats/biologiya.png)
Biology, 10.02.2020 17:15
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
History, 10.02.2020 17:15
![question](/tpl/images/cats/en.png)
English, 10.02.2020 17:15
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 10.02.2020 17:15
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 10.02.2020 17:15