subject
Biology, 28.07.2021 15:50 Crxymia

Ġ Surface area te volume ratio plays a vital role in À. growth rate of organisms B. exchange of materials between organisms and their environment C. the life-span of organisms D. efficiency of various systems in organisms ​

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 03:30
What organelle other than the nucleus houses dna in a eukaryotic cell?
Answers: 1
question
Biology, 22.06.2019 04:00
The wings of insects, birds, and bats evolved independently but carry out similar functions. this is an example of a. analogous structures. b. embryonic structures. c. vestigial structures. d. homologous structures.
Answers: 1
question
Biology, 22.06.2019 09:30
What material did the moon come from?
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Ġ Surface area te volume ratio plays a vital role in À. growth rate of organisms B. exchange of mate...
Questions
question
Computers and Technology, 21.05.2021 01:30
question
Mathematics, 21.05.2021 01:30
question
Arts, 21.05.2021 01:30
question
English, 21.05.2021 01:30
question
History, 21.05.2021 01:30
Questions on the website: 13722363