Answers: 1
Biology, 22.06.2019 00:10
The kind of fertilization found in the majority of aquatic animals is (internal or external) fertilization.
Answers: 1
Biology, 22.06.2019 00:10
Lymphatic vessels remove excess fluid from tissues. often after mammexront( the surgical procedure to remove of all or part of a breast) the lymphatic vessels draining the arm are damaged. explain a consequence of this damage. what can be done to reduce the symptoms?
Answers: 3
Biology, 22.06.2019 06:50
Drag the tiles to the correct boxes to complete the pairs. match the nitrogenous base of dna with its complement.
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
What are three blood cells in a human body...
History, 09.02.2021 17:30
Mathematics, 09.02.2021 17:30
Mathematics, 09.02.2021 17:30
Mathematics, 09.02.2021 17:30
Law, 09.02.2021 17:30
Mathematics, 09.02.2021 17:30
Social Studies, 09.02.2021 17:30
Physics, 09.02.2021 17:30
Mathematics, 09.02.2021 17:30
English, 09.02.2021 17:30
Mathematics, 09.02.2021 17:30