subject
Biology, 02.09.2021 14:00 pillgiing

2. Identify each of the following as either an open, closed, or isolated system: a. Reef ecosystem:
b. Nitrogen cycle:
c. Earth:
d. Biosphere:
e. Solar system:
f. Digestive system:
g. A national park:
h. A large lake:

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 15:00
20 points asap! question 1 - in your own words, explain the scientific evidence that supports the plate tectonic theory. question 2 - in your own words, explain why the geological structures in florida are different from the geological structures in colorado.
Answers: 1
question
Biology, 22.06.2019 08:20
The table lists the observations students made about four specimens under a microscope. based on these observations, what specimens did the students examine? animal plant virus prokaryote cell membrane present ribosomes present lysosomes present nuclear membrane present cell wall present ribosomes present nuclear membrane absent cell wall present ribosomes present nucleus present large vacuole present reproduces inside of a cell nucleus absent rna present 2019 edmentum all rights reserved intl
Answers: 2
question
Biology, 22.06.2019 11:00
Across of blue x blue (both heterozygous) would result in
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
2. Identify each of the following as either an open, closed, or isolated system: a. Reef ecosystem...
Questions
question
Mathematics, 16.11.2019 10:31
question
Social Studies, 16.11.2019 10:31
question
Mathematics, 16.11.2019 10:31
Questions on the website: 13722367