Please help me this​

Which statement best describes a typical difference that could be found between the "analysis" and "conclusion" sections of a lab report? a) only the "conclusion" describes errors that occurred during the experiment, and only the "analysis" section suggests further research.b) only the "analysis" section includes specific data comparisons, and only the "conclusion" section suggests further research.c) only the "analysis" section discusses whether the original hypothesis was supported, and both sections include graphs of data.d) only the "conclusion section discusses whether the original hypothesis was supported, and both sections suggest further research.(the answer is b i just took the test)

In a hypothetical breed of dogs, coat color is controlled by two genes. there are six different coat colors in this breed: black, brown, cream, gray, silver, and tan. consider the following crosses. cross 1: black females from a lineage of all black dogs are crossed with brown males from a lineage of all brown dogs. f1 males and females are all black. when f1 are intercrossed, f2 males and females are black or brown. cross 2: black females from a lineage of all black dogs are crossed with tan males from a lineage where all males are tan and all females are cream. f1 males are black, f1 females are gray. when f1 are intercrossed, f2 males and females are black, brown, gray, or tan. cross 3: silver females from a lineage where all females are silver and all males are gray are crossed with brown males from a lineage of all brown dogs. f1 males and females are all gray. when f1 are intercrossed, f2 males are black, brown, gray, or tan, f2 females are cream, gray, silver, or tan. select the correct statements regarding the mode of inheritance of the coat color genes. a) both genes are x-linked. b) both genes are autosomal. c) one of the genes modifies the expression of the other gene. d) each gene has an additive effect on the intensity of coat color. e) each gene independently specifies three colors. f) one of the genes is autosomal, and the other is x-linked.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?