Nondisjunction has resulted in an extra copy of one chromosome 5 points
Turner syndrome is a chromosomal mutation resulting from
nondisjunction during meiosis informing either sperm or egg cells. Which
of the following genetic technologies would be best to determine the
presence of this chromosomal mutation?
DNA fingerprinting
Karyotyping
Gene therapy
Recombinant DNA technology
Scientist have genetically modified Atlantic salmon to include an extra cat

Astudent conducts an experiment to determine how the amount of water given to a plant affects it growth what is the dependent variable for this experiment

According to this food web which of the following would be considered primary consumers

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?