Biology, 02.10.2021 14:00 IHeartDarkSide03
What material reads the genetic information carried by DNA and guides the protein making process
Answers: 2
Biology, 22.06.2019 03:30
Matthew decided he wanted to hike up mount everest. on his way to the top, it began to snow and the temperature dropped to -10°f. matthew forgot to wear a heavy jacket so his body began to shiver beyond control. in this case, matthew's body shivering is the to a drop in temperature. * 0 points reflex stimuli responce environmental facto
Answers: 1
Biology, 22.06.2019 08:50
You are observing different types of cells in your science lab. one cell has many chloroplasts. what is the most likely function of this cell? a. energy production b. photosynthesis c. reproduction d. digestion
Answers: 1
Biology, 22.06.2019 08:50
If the nucleus of a cell was removed the cell wouldn’t be able to make proteins because
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
What material reads the genetic information carried by DNA and guides the protein making process...
History, 11.07.2019 02:20
History, 11.07.2019 02:20
Physics, 11.07.2019 02:20