Window Help
Bookmarks
Edit
View
History
Safari
File
Genetic Variation from Meiosis Quick Check
Genetic Variation from Meiosis Quick Check
Why is it important for gametes to be haploid? (1 point)
When gametes are made, the diploid cell splits twice, creating four haploid organisms
It is impossible for them to be diploid bengi

The first three phases of the cell cycle are collectively known as (1 point) play audio cellular respiration. telophase. mitosis. interphase.

1. fold your hands together so your thumbs cross over ,and look at your thumbs. which thumb feels most "comfortable" on top is actually controlled by a gene. the left thumb folding over the right thumb is a domi

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?