Biology, 28.10.2021 01:00 sandrafina2004
in eukaryotes, the first amino acid in a growing polypeptide chain is always because the only codon for this amino acid is also the codon.
Answers: 2
Biology, 22.06.2019 05:00
Dna. we have heard that we are a product of our dna. but where is it? how do we "get" our dna? it is passed to us, from our parents, but in what form? several vocabulary words associated with inheritance are used interchangeably and sometimes, incorrectly. let's see if you can clear this up for someone just learning about inheritance and cell structure.
Answers: 2
Biology, 22.06.2019 08:30
Both male and female gametes are created during the process of meiosis. the formation of male gametes is called spermatogenesis. after telophase il of spermatogenesis, there would be are all genetically male gametes created that
Answers: 2
Biology, 22.06.2019 10:00
Suppose you use three different scale to weigh a bag of organges. one scale says the nag weighs 2.1 lb, and third says it weighs 2.1 lb. the actual weight of the bag of organges is 2.153 lb. which of the following best decribes these results?
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
in eukaryotes, the first amino acid in a growing polypeptide chain is always because the only codon...
Mathematics, 14.10.2020 18:01
Mathematics, 14.10.2020 18:01
Mathematics, 14.10.2020 18:01
Biology, 14.10.2020 18:01
Social Studies, 14.10.2020 18:01
Mathematics, 14.10.2020 18:01
Mathematics, 14.10.2020 18:01
Geography, 14.10.2020 18:01
English, 14.10.2020 18:01
Mathematics, 14.10.2020 18:01