![subject](/tpl/images/cats/biologiya.png)
Biology, 02.11.2021 03:50 abrown6758
3) In Georgia, there are specific rules and daily catch limits when it comes to fishing. For example, the daily limit for largemouth bass is 10, rainbow trout is 8, and there is no daily catch limit for catfish. Which of these best explains why Georgia has regulations on the number of specific fish that can be caught daily?
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 22:00
Ry was studying two populations of the same species of lizards. one population lived on an island and the other lived on the mainland. both populations were affected by a hurricane that hit the island and the mainland with equal force. a year later, henry was testing the gene frequency and saw a decrease in genetic variation in the island species, but not in the mainland species. which best describes a conclusion he might have reached? gene flow greatly affects small populations, but large populations can recover. genetic drift greatly affects small populations, but large populations can recover. gene flow greatly affects large populations, but small populations can recover. genetic drift greatly affects large populations, but small populations can recover.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 04:50
What part of the brain is highlighted in the diagram below?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:00
What should be the strand of complementary dna produced by the strand of dna shown below cgt ata
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
3) In Georgia, there are specific rules and daily catch limits when it comes to fishing. For example...
Questions
![question](/tpl/images/cats/biologiya.png)
Biology, 06.07.2019 09:00
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 06.07.2019 09:00
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 06.07.2019 09:00
![question](/tpl/images/cats/biologiya.png)
Biology, 06.07.2019 09:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/geografiya.png)
Geography, 06.07.2019 09:00
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 06.07.2019 09:00
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/ekonomika.png)
Business, 06.07.2019 09:00
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
History, 06.07.2019 09:00
![question](/tpl/images/cats/ekonomika.png)
Business, 06.07.2019 09:00
![question](/tpl/images/cats/himiya.png)
Chemistry, 06.07.2019 09:00
![question](/tpl/images/cats/ekonomika.png)
Business, 06.07.2019 09:00
![question](/tpl/images/cats/himiya.png)
Chemistry, 06.07.2019 09:00
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 06.07.2019 09:00