2. a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the direction (5' and 3') of the two DNA strands. +1 -10 -35 ZPTTGCATCCGAAACGTACGATCGATCGGCCGACT TATTACGATCGGACTACTGCGTCGTAGC5'... ...5AACGTAGGCTTTGCATGCTAGCTAGCCGGCT GAATAATGCTAGCCTGATCACGCAGCATCG3"... (1) Write the first 12 nucleotides of the RNA molecule transcribed from this gene. (1 mark) (Explain why the Start codon does not appear in the first three nucleotides of the sequence transcribed in (i). (1 mark)