Select all the correct answers.
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The red letters are the noncoding region, and the black letters are the protein coding region.
ATTAGCATACTACGGGC
ATTTGCATACTGACCGGGC
ATTTGCAATACTACCGGGC
ATTTGCAACTACCGGGC
ATGAATGCATACTACCGGGC
Answers: 2
Another question on Biology
Biology, 21.06.2019 19:30
As global warming continues the ocean absorbs more of the earth's heat what term describes the ocean as a storage location for heat a) heat binb) heat sinkc) heat storaged) heat vent( answer this for me)
Answers: 2
Biology, 21.06.2019 21:30
Many animals cannot sweat to maintain a stable body temperature. what is one other way animals can cool down?
Answers: 2
Biology, 22.06.2019 06:40
Which of these has happened to your food by the time it reaches your small intestine? a. all the macromolecules have been broken down completely. b. lipids and starches have been partially broken down. c. starches and proteins have been partially broken down. d. proteins and lipids have been broken down into subunits.
Answers: 3
Biology, 22.06.2019 14:00
Which diagram best represents the chromosomes that would be found in a two new skin cells produced as a result of this process?
Answers: 1
You know the right answer?
Select all the correct answers.
This sequence encodes for a particular protein that helps bacteria...
Questions
Social Studies, 21.11.2020 23:30
Social Studies, 21.11.2020 23:30
Social Studies, 21.11.2020 23:30
Biology, 21.11.2020 23:30
Mathematics, 21.11.2020 23:30
Mathematics, 21.11.2020 23:30
Mathematics, 21.11.2020 23:30
Social Studies, 21.11.2020 23:30
English, 21.11.2020 23:30
Mathematics, 21.11.2020 23:30
Mathematics, 21.11.2020 23:30
