Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:20
First idea: suddenly, women were leaving their homes to cycle and socialize on country roads and city streets. —wheels of change, sue macy second idea: it was not a stretch for some cyclists to see the possibility of a larger role for women in the world. —wheels of change, sue macy what type of graphic organizer would best represent the connection between these two ideas? 1) a t-chart that separates ideas into two different categories 2) a chronology that shows 3) a sequence of several events a cause-and-effect graphic that shows how one idea led to another 4)a problem-solution graphic that presents a problem and a solution to the problem
Answers: 2
Biology, 22.06.2019 14:20
What term describes a doctor who becomes a specialist by meeting standards beyond those of getting a license and passing a test in the specialty area?
Answers: 1
Biology, 22.06.2019 17:10
If a force of 40 newtons moves a cart a distance of 9 meters, the work done is nm. if the same force moves the same cart three times that distance, the work done is nm.
Answers: 1
Into what organelle might the cellular products be placed?...
Computers and Technology, 22.04.2020 23:54
History, 22.04.2020 23:54
Health, 22.04.2020 23:54
Biology, 22.04.2020 23:54
Mathematics, 22.04.2020 23:54
Social Studies, 22.04.2020 23:54
Biology, 22.04.2020 23:54