Need help look at pdf/link part 5. a b and c
1. Use this sequence of DNA to answer the following former test questions:
5’-- TTAATGGGACAGCTTGTGTAGAGG --3’
a. What is the complementary strand of DNA?
b. Using the complementary strand of DNA (your answer from part a) as the template
strand, what is the transcribed mRNA sequence?
c. What is the amino acid sequence translated from the strand of mRNA synthesized in
part b (use the genetic code below)?
Remember:
i. Start codon!
ii. Stop codon!
Chart in pdf
Answers: 1
Another question on Biology
Biology, 22.06.2019 05:20
The large increase in atmospheric carbon dioxide in the last 50 years most likely comes from a. an increase in cellular respiration b. increased decomposition by bacteria c. an increase in the burning of fossil fuels d. an increase in photosynthesis
Answers: 3
Biology, 22.06.2019 06:40
The first generation of offspring from the cross of two parents is called the a.f1 generation b.f2 generation c.short generation d.p generation
Answers: 1
Biology, 22.06.2019 09:40
Explain how paleontologists use trilobite fossils as index fossils for various geologic time periods.
Answers: 1
Biology, 22.06.2019 09:50
Tropical rain forests support more species per unit area than any other terrestrial ecosystem. what is one way rain forests are important to the health of the biosphere?
Answers: 1
You know the right answer?
Need help look at pdf/link part 5. a b and c
1. Use this sequence of DNA to answer the following f...
Questions
Chemistry, 20.02.2021 02:10
Social Studies, 20.02.2021 02:10
English, 20.02.2021 02:10
English, 20.02.2021 02:10
Mathematics, 20.02.2021 02:10
Mathematics, 20.02.2021 02:10
Mathematics, 20.02.2021 02:10
Mathematics, 20.02.2021 02:10
Physics, 20.02.2021 02:10
