Biology, 06.12.2021 08:40 sadsociety41
1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5'
Type of mutation ( 3pts):
Amino acid ( 3pts):
Type of mutation ( 3pts):
2. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACGCGCTTACGTCTGATCGCT 5'
Type of mutation ( 3pts):
Amino acid ( 3pts):
Type of mutation ( 3pts):
3. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' 5'
Type of mutation (3pts):
Amino acid ( 3pts):
Type of mutation ( 3pts):
4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' 5'
Type of mutation ( 3pts) :
Amino acid ( 3pts):
Type of mutation ( 3pts):
5. What is the difference between a point mutation and a frameshift mutation? 4pts
Answers: 2
Biology, 21.06.2019 19:00
One statements is an example of a scientific observation. another statement is an example of a scientific explanation. identify the correct statement for each category to illustrate how scientific explanations are inferred from scientific observations.
Answers: 3
Biology, 22.06.2019 17:00
An uncomfortable feeling in the ears when descending in an airplane is caused by changes in air pressure on the: a. inner ear b. middle ear c. eardrum d. hammer/anvil
Answers: 2
Biology, 22.06.2019 23:00
Why is there more biomass at the producer level that at the consumer levels ? how does this relate to the 10% rule ?
Answers: 2
Biology, 23.06.2019 01:30
The diagram shows one step in the process protein synthesis. the process shown in the diagram is called
Answers: 1
1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACATCCGCTTACGTCTGA...
History, 13.01.2021 18:40
Mathematics, 13.01.2021 18:40
English, 13.01.2021 18:40
Chemistry, 13.01.2021 18:40
Mathematics, 13.01.2021 18:40
Mathematics, 13.01.2021 18:40
Mathematics, 13.01.2021 18:40
Mathematics, 13.01.2021 18:40
History, 13.01.2021 18:40
Social Studies, 13.01.2021 18:40
Computers and Technology, 13.01.2021 18:40
Chemistry, 13.01.2021 18:40
Arts, 13.01.2021 18:40