3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' 5'

Type of mutation (3pts):

Amino acid ( 3pts):

Type of mutation ( 3pts):

4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mutated DNA sequence: 3' 5'

Type of mutation ( 3pts) :

Amino acid ( 3pts):

Type of mutation ( 3pts):

Christie's doctor recommends that she eat 40 grams of protein a day. she's already consumed 50% of her protein recommendation for the day. how many servings of the given snack should christie have to meet her daily protein recommendation?

Select the best answer for the question, ly 12. which of the following behaviors is not an inherited behavior?

The sketch shows a rynchosaur, an extinct animal that is known only from fossils. there has been much debate about the classification of these creatures. some scientists suggest that they belong with primitive amphibians, and some think they are related to snakes and lizards.the data equally support both cases. which statement best explains how to draw a cladogram that includes the rynchosaur? draw the cladogram for amphibians. draw the cladogram for reptiles. draw two cladograms, both showing the traits, and leave it as a hypothesis. draw two cladograms, both showing the traits, and have scientists vote