Human cells have 46 chromosomes. Each chromosome consists of a pair of identical chromatids attached together by a structure called a centromere. Once the chromosome has split, each chromatid is called a daughter chromosome. At the end of cytokinesis, how many daughter chromosomes will be found in each cell? Explain.

Agroup of students are walking in the park, and one of them takes a picture of a pollen grain that is being blown by the wind.what caption can the student use for this picture? fahrte "littl1111111nimmt-hhhfull film# # #gene mutation in actiongene flow at workgenetic drift as it happensnatural selection in progresshii

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

The open ocean of any depth is called the