AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

the level of progesterone is low at the pre-ovulatory phase of the cycle but it gradually increases and the levels are high at the luteal phase. if pregnancy occurs, the level of progesterone will be high throughout the pregnancy.

if egg is fertilized and the mother gets pregnant, progesterone starts preparing the uterus for the implantation. it starts building up the lining of uterus and make it hostile of the period of pregnancy.