subject
Biology, 16.03.2022 05:20 yrodrig13

The mitochondria are the organelles where takes place and most is produced. A) citric acid cycle; ATP
B) catabolism; acetyl coenzyme A
C) catabolism; ATP
D) citric acid cycle; acetyl coenzyme A

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 00:00
Molecular models of two different substances are shown below. in the molecule on the left, the oxygen atom pulls on electrons more strongly than the hydrogen atoms. in the molecule on the right, the two oxygen atoms pull on the shared electrons with the same strength. water molecule, h,o oxygen molecule, oz when the two substances are put in the same container, they do not attract each other. why does this happen? a. they both contain oxygen. b. one is polar and one is nonpolar. c . they are both polar. d. they contain different elements.
Answers: 1
question
Biology, 22.06.2019 10:30
There are fewer than 100 naturally occurring elements in the universe, but there are millions of different unified substances. explain how this can be true.
Answers: 1
question
Biology, 22.06.2019 11:30
Why do some dna fragments move farther than others during gel electrophoresis? a. because their shapes are different b. because they are different types of molecules c. because the samples are different colors d. because their masses are different
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
The mitochondria are the organelles where takes place and most is produced. A) citric acid cycle...
Questions
Questions on the website: 13722359