Answers: 1
Biology, 21.06.2019 23:00
The dna in a cell’s nucleus encodes proteins that are eventually targeted to every membrane and compartment in the cell, as well as proteins that are targeted for secretion from the cell. for example, consider these two proteins: phosphofructokinase (pfk) is an enzyme that functions in the cytoplasm during glycolysis. insulin, a protein that regulates blood sugar levels, is secreted from specialized pancreatic cells. assume that you can track the cellular locations of these two proteins from the time that translation is complete until the proteins reach their final destinations.for each protein, identify its targeting pathway: the sequence of cellular locations in which the protein is found from when translation is complete until it reaches its final (functional) destination. (note that if an organelle is listed in a pathway, the location implied is inside the organelle, not in the membrane that surrounds the organelle.)
Answers: 3
Biology, 21.06.2019 23:30
You can tell from this karyotype that the individual is female because the karyotype has two chromosomes labeled
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:50
The largest unit within which gene flow can readily occur is a
Answers: 3
What role do glucose and oxygen play in cellular respiration?...
Social Studies, 18.02.2020 21:51
Biology, 18.02.2020 21:51
Geography, 18.02.2020 21:51
English, 18.02.2020 21:51
English, 18.02.2020 21:51
Mathematics, 18.02.2020 21:51
Mathematics, 18.02.2020 21:52
Mathematics, 18.02.2020 21:52
Mathematics, 18.02.2020 21:52