![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 15:50
Which term best describes a community in which people work mostly in factories? a.agricultural. b.hunting and gathering. c.domesticated. industrial.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 16:20
Which example best describes a reflex action? a. eating food when hungry b. coughing when the throat is irritated c. bending down to lift a heavy object d. going for a walk outside
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 21:00
Mulitple choice which of the following is a function of the nucleus? a. stores dna b. stores sugars c. builds proteins d. packages proteins
Answers: 1
You know the right answer?
Discuss the term "survival of the fittest" was developed and what it means....
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 03.12.2020 06:50
![question](/tpl/images/cats/mat.png)
Mathematics, 03.12.2020 06:50
![question](/tpl/images/cats/himiya.png)
Chemistry, 03.12.2020 06:50
![question](/tpl/images/cats/mat.png)
Mathematics, 03.12.2020 06:50
![question](/tpl/images/cats/mat.png)
Mathematics, 03.12.2020 06:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 03.12.2020 06:50
![question](/tpl/images/cats/mat.png)
Mathematics, 03.12.2020 06:50
![question](/tpl/images/cats/mat.png)
Mathematics, 03.12.2020 06:50
![question](/tpl/images/cats/mkx.png)
![question](/tpl/images/cats/en.png)
English, 03.12.2020 06:50
![question](/tpl/images/cats/mat.png)
Mathematics, 03.12.2020 06:50
![question](/tpl/images/cats/mat.png)
Mathematics, 03.12.2020 06:50
![question](/tpl/images/cats/istoriya.png)
History, 03.12.2020 06:50
![question](/tpl/images/cats/en.png)
English, 03.12.2020 06:50
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 03.12.2020 06:50
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 03.12.2020 06:50