Biology, 11.07.2019 07:00 alyssamonae
Any statements about optimal population are inevitably culturally determined. a. true b. false
Answers: 1
Biology, 21.06.2019 20:50
Next pretest: evolution select the correct answer in a laboratory population of flies, the female flies are gray and the males are yellowish gray. biologists observed that all the male flies had an equal chance for reproduction, but the male flies with the brightest colors were more likely to successfully reproduce. what phenomenon could explain such a change? a sexual selection b. disruptive selection c. stabilizing selection d. directional selection
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 20:00
Transposon can cause mutations in genes at or near the site of transposon insertion. it is possible for these elements to transpose away from their original site, causing a reversion of the mutant phenotype. in some cases, however, even more severe phenotypes appear when these elements excise from this site, due to events at or near the mutant allele. what might be happening to the transposon or the nearby gene to create more severe mutations?
Answers: 2
Any statements about optimal population are inevitably culturally determined. a. true b. false...
Physics, 25.01.2020 03:31
English, 25.01.2020 03:31
Mathematics, 25.01.2020 03:31
Business, 25.01.2020 03:31
English, 25.01.2020 03:31
Mathematics, 25.01.2020 03:31
History, 25.01.2020 03:31
Biology, 25.01.2020 03:31
Chemistry, 25.01.2020 03:31
History, 25.01.2020 03:31
Mathematics, 25.01.2020 03:31
Mathematics, 25.01.2020 03:31