Biology, 14.07.2019 20:30 jonmorton159
Which organic compound has this component? dna carbohydrates lipids nucleic acids proteins?
Answers: 1
Biology, 21.06.2019 20:00
After reading the paragraph below, answer the questions that follow. researchers have created a robot that has a very thin leg that is moved by cardiac (heart) cells contracting in unison. the robot, made of a polymer similar to that used in making contact lenses, is bathed in heart cells with supporting cells, which then attach to the robot and provide movement as they contract. all of the cardiac cells working together can cause the robot leg to move in a way that individual cells could not. this is an example of a. emergent properties of cells. b. energy flow through an ecosystem. c. adaptation. d. internal environment regulation.
Answers: 3
Biology, 22.06.2019 08:30
Construct at least two possible hypotheses for the student’s experiment.
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Which organic compound has this component? dna carbohydrates lipids nucleic acids proteins?...
Business, 13.10.2020 02:01
Arts, 13.10.2020 02:01
Physics, 13.10.2020 02:01
Advanced Placement (AP), 13.10.2020 02:01
Mathematics, 13.10.2020 02:01
Biology, 13.10.2020 02:01
Mathematics, 13.10.2020 02:01
Mathematics, 13.10.2020 02:01
Mathematics, 13.10.2020 02:01
English, 13.10.2020 02:01
Chemistry, 13.10.2020 02:01
History, 13.10.2020 02:01
Mathematics, 13.10.2020 02:01