![subject](/tpl/images/cats/biologiya.png)
Biology, 17.07.2019 20:40 lekaje2375
This is a dna fingerprint exhibiting samples from a victim, two suspects, and the crime scene. which of these dna fragments is common to both the victim and suspect 2?
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:00
How is ribosomal rna useful as a molecular clock? a. a large portion of the dna ring is not vital to structure or function, allowing it to accumulate neutral mutations. b. its rate of mutation increases over time as organisms continue to evolve and differentiate from each other. c. a slow mutation rate makes it useful for determining evolutionary relationships between ancient species. d. it is only found in select organisms, making it easier to compare relationships between species that have it.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:20
The negative change found inside the plasma membrane is created by potassium ions sodium ions hydrogen ions chlorine ions
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:20
Astudent analyzed ears of corn that demonstrated two traits in the f2 kernels, purple or white colors and smooth on wrinkled shapes. a tabulation of 135 individual kernels gave the following results: purple and smooth = 75 white and smooth = 28 purple and wrinkled = 24 white and wrinkled = 8 what would be the only phenotype present in the f1 ger
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
This is a dna fingerprint exhibiting samples from a victim, two suspects, and the crime scene. which...
Questions
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 06.12.2020 02:50
![question](/tpl/images/cats/en.png)
English, 06.12.2020 02:50
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 06.12.2020 02:50
![question](/tpl/images/cats/biologiya.png)
Biology, 06.12.2020 02:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
Business, 06.12.2020 02:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/health.png)
Health, 06.12.2020 02:50
![question](/tpl/images/cats/en.png)
English, 06.12.2020 02:50
![question](/tpl/images/cats/mat.png)
Mathematics, 06.12.2020 02:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)