Biology, 20.07.2019 05:00 neptunesx

At the grocery store a cute, little curly-haired child is standing behind you in line. you turn around for a moment and she sticks her tongue out at you. which tongue muscle did she use?

Answers: 1

Show answers

Another question on Biology

Biology, 22.06.2019 00:00

You decide that the introduction should also discuss the extremophiles that are referred to as the archaea. these single-cell organisms are considered "extremophiles" due to their ability to survive and reproduce in environmental conditions that would be hostile for most living organisms. archaea species have been isolated from highly acidic sulfur springs, ocean floor thermal vents with temperatures that exceed boiling, and subarctic ice well below freezing. while still considered to be prokaryotic, the archaea have numerous differences that place them apart from the bacteria. choose the characteristics that separate the archaea from other prokaryotic cells. select all that apply. view available hint(s) select all that apply. archaea lack true peptidoglycan in their cell walls. the morphology of the cell is rigid and is geometric in shape, similar to a sphere or cylinder. the cytoplasmic membrane lipids of archaea have branched or ringform hydrocarbon chains. all currently identified and characterized archaea have been linked as the causative agent to an animal or human disease.

Answers: 2

Answer

Biology, 22.06.2019 03:00

Which statement best describes the relationship between an allele and a gene? question 1 a. an allele is a variation of a gene that can be expressed as a phenotype. b. an allele is the part of a gene that attaches to messenger rna molecules. c. an allele is a segment of a dna molecule that controls replication of a gene.

Answers: 3

Answer

Biology, 22.06.2019 07:00

Time remaini 02: 50: 5 in the farewell speech, queen elizabeth's use of first-person point of view her to appear to be impartial and objective prevents her from addressing the audience directly allows her to share her personal thoughts and ideas, makes it seem as though she's observing from the outside, mack this and return save and evit

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

At the grocery store a cute, little curly-haired child is standing behind you in line. you turn arou...

Questions