subject
Biology, 22.07.2019 06:40 allenlog000

Scientists discovered that this enhancer associated with hair color has a binding site for a particular transcription factor. one form of the binding site has the sequence cactaaag and is associated with dark hair, and the other form of the binding site has the nearly identical sequence cgctaag and is associated with blond hair. how could these two nearly identical enhancer binding sites lead to different rates of initiating transcription of the regulated gene?

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 17:00
Which of the following protists gets nutrients mainly by absorbing molecules from other organisms through their cell walls and cell membranes? a. amoebas b. water molds c. ciliates d. slime molds
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:30
The direct energy source that drives atp synthesis during respiratory oxidative phosphorylation is
Answers: 1
question
Biology, 22.06.2019 20:00
Ineed / the answer on this question you!
Answers: 1
You know the right answer?
Scientists discovered that this enhancer associated with hair color has a binding site for a particu...
Questions
question
History, 23.05.2020 21:58
Questions on the website: 13722360