subject
Biology, 23.07.2019 14:20 zarzuba

Nthe pleistocene period 10,000 years ago, there was a remarkable extinction of vertebrates in many continents, which may explain why the cheetah has famously low levels of genetic variation. which evolutionary mechanism does this reflect?

ansver
Answers: 1

Another question on Biology

question
Biology, 20.06.2019 18:04
After which event could you say that evolution has occurred? question 1 options: an allele frequency changes in a population. a white-eyed fly is born into a population of brown-eyed flies. a new predator comes into an environment. an animal gets fat.
Answers: 2
question
Biology, 21.06.2019 22:00
What types of energy transfers and energy transportations are involved in the domino chain reaction?
Answers: 1
question
Biology, 22.06.2019 10:30
How do the evolutionary chart and the video support the claim that all living things are made up of cells?
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Nthe pleistocene period 10,000 years ago, there was a remarkable extinction of vertebrates in many c...
Questions
question
Mathematics, 24.01.2020 05:31
question
Mathematics, 24.01.2020 05:31
question
Mathematics, 24.01.2020 05:31
Questions on the website: 13722362