subject
Biology, 29.07.2019 12:20 kashishmehta917

When fats first reach the duodenum what their presence stimulates the release of which hormone from the intestinal mucosal cell?

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 16:30
As , plants meet their needs for making food from air, soil, water, and the sun's energy in a process called there are plants called grow high in trees without here are words to put in the blanks. 1.) producers 2.) consumers 3.) chloroplasts 4.) epiphytes
Answers: 1
question
Biology, 22.06.2019 04:10
Select the correct answer. tay-sachs disease is caused by a mutation in the hexa gene located on chromosome 15. tay-sachs follows an autosomal recessive pattern of inheritance. with the of the diagram, identify which of the offspring will be an unaffected carrier. a diagram showing the genes of parents who are carriers of tay-sachs disease a. a, b, and c b. b and c c. a and d d. a e. d
Answers: 3
question
Biology, 22.06.2019 08:00
This is a situation in which genes are attached to an organism's sex chromosomes; the sex of an organism influences the expression of a gene.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
When fats first reach the duodenum what their presence stimulates the release of which hormone from...
Questions
question
Mathematics, 15.12.2020 04:20
question
Mathematics, 15.12.2020 04:20
question
Health, 15.12.2020 04:20
question
Computers and Technology, 15.12.2020 04:20
question
Mathematics, 15.12.2020 04:20
Questions on the website: 13722359