subject
Biology, 03.08.2019 14:50 JuanTorres7

Why do experiments usually require a control?

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 19:40
In german cockroaches, curved wing (cv) is recessive to normal wing (cv+). bill, who is raising cockroaches in his dorm room, finds that the frequency of the gene for curved wings in his cockroach population is 0.6. in his friend joe’s apartment, the frequency of the gene for curved wings is 0.2. one day joe visits bill in his dorm room, and several cockroaches jump out of joe’s hair and join the population in bill’s room. bill estimates that, now, 10% of the cockroaches in his dorm room are individual roaches that jumped out of joe’s hair. what is the new frequency of curved wings among cockroaches in bill’s room? 0.69 0.4 0.5 0.31 0.20
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 15:30
Which one is an advantage of external fertilization a. the offspring are genetically identical to the parents b. more eggs can be fertilzed at one time c. more sperm can be released at one time d. more protection is available for developing plz
Answers: 1
question
Biology, 22.06.2019 17:50
Babies with very low or very high birth weight are less likely to survive. observe a graph of the data. % babies born at different weights % babies born in that category 6.0 6.5 in 50-555 70-75 80-8511 100-1055 which statement is a valid claim that could be made using the data in the graph? directional selection is occurring because the graph favors an extreme. mark this and retum save and exit next submit o type here to search
Answers: 2
You know the right answer?
Why do experiments usually require a control?...
Questions
question
Mathematics, 05.03.2021 18:10
question
Mathematics, 05.03.2021 18:10
question
Mathematics, 05.03.2021 18:10
question
Spanish, 05.03.2021 18:10
question
Mathematics, 05.03.2021 18:10
question
Mathematics, 05.03.2021 18:10
question
Social Studies, 05.03.2021 18:10
Questions on the website: 13722360