To which of the following dna sequences would the tata box binding protein bind? a. taggcgtatatagcgccttat b. cccgttaattaattaacgcgc c. gcgcttatctattaccgtacg d. atcgattccgatactatgcta

To store strawberries in sugar syrup, lucy placed them in a jar and covered them with sugar but did not add any water. do you think syrup will be formed? justify. a. no. since water is not added, there cannot be any syrup formation. b. no. the higher concentration of sugar on the outside will cause the water from the sugar to diffuse in the strawberry cells causing them to swell without formation of any syrup. c. yes. the higher concentration of sugar on the outside will cause the water from the strawberry to diffuse out resulting in syrup formation. d. yes. the sugar will melt over time and form the syrup.