Low-quality energy has significant environmental implications because

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Is dna the same in every cell in the human body explain your answer

(me out over the last several centuries, scientists have made the following broad observations while investigating several branches of the life sciences: -the fossil record shows that different types of organisms have existed at different times in earth's history. -many organisms have similar body structures that seem to be adapted to different ways of living in their environment. -organisms of different species often share similarities in stages of embryonic development. -many species share genetic similarities, and almost all organisms use the same basic building blocks to construct proteins. -often, the extent of two species' similarities can be predicted from their geographic closeness to each other. -a great deal of change has been observed among species that have experienced strong selective pressures through many generations. scientists have carefully considered and rigorously tested the observations listed above. when scientists offer a of these observations, they are making 1.) testable explanation, deductive explanation 2.) scientific interference, scientific law