What is defined as the movement of water across a semipermeable membrane from high concentration to low concentration?

In a classic experiment using pea shape, mendel conducted two separate genetic crosses. in the first cross the parent plants were “true breeding” for pea shape; one had round peas ( r )and the other had wrinkled (r). the first cross produced a filial 1 generation of all round peas. in the second cross, mendel bred plants from the filial 1 generation. this cross produced different results. out of approximately 1000 plants, about 75% were round and 25% were wrinkled.

Duchenne muscular dystrophy is a serious condition caused by a recessive allele of a gene on the human x chromosome. the patients have muscles that weaken over time because they have absent or decreased dystrophin, a muscle protein. they rarely live past their twenties. how likely is it for a woman to have this condition? a) women can never have this condition.b) one-fourth of the daughters of an affected man would have this condition.c) one-half of the daughters of an affected father and a carrier mother could have this condition.d) only if a woman is xxx could she have this condition.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?