Biology, 28.07.2019 11:30 wolfiewolffromsketch

4. change any base (between the reading frame, excluding the start and stop codons) and show the change in the amino acid 5’ 3’ 3’ 5’ 5. insert any base anywhere (between the reading frame, excluding the start and stop codons) and show the change in the amino acid sequence 5’ 3’ 3’ 5’

Answers: 1

Show answers

Answers

Answer from: kingo7

Q1)

the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.

5’ agcggg atg agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here
we change base A to T (capitalised)

DNA sequence with amino acids are given
5’ agcggg atg Tgc gca tgt ggc gca taa ctg 3’
N   Met Cys Ala Cys  Gly Ala stop
after changing the base the amino acid sequence changes from Ser to Cys.

Q2)
the complementary strand of the above strand is as follows
5' 3'
start codon starts with atg thats where the reading frame starts
5' cagtt atg cgc  cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt atg cgc  cac atg cgc Aca tcc cgc t 3'
  Met Arg His Met Arg Thr Ser Arg
amino acid changes from Ser to Thr.

Q3)
The sequence with amino acids before inserting a base is
5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
We insert a base G shown in capitals
5’ agcggg atg agc Ggca tgt ggc gca taa ctg 3’

This changes the codons of bases after the inserted base
5’ agcggg atg agc ggc atg  tgg cgc ata act g 3’
Met Ser Gly Met Trp Arg Ile Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
to   Met Ser Gly Met Trp Arg Ile Thr

Q4)
the complementary strand before adding a base is
5' cagtt atg cgc  cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
When we insert a base G, base C is added to the complementary strand
5' cagtt atg cgc  cac atg cCgc tca tcc cgc t 3'
this changes the codons
5' cagtt atg cgc  cac atg cCg ctc atc ccg ct 3'
Met Arg His Met Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from
Met Arg His Met Arg Ser Ser Arg
to Met Arg His Met Pro Leu Ile Pro

Answer from: Quest

the contamination

we are putting to many trash.

Answer from: Quest

This movement is also referred to as glacial plucking

Another question on Biology

Biology, 21.06.2019 20:00

Microorganisms are involved in each of the following processes excepta. smog production.b. food production.c. infection.d. o2 production.e. decomposition of organic material.

Answers: 1

Answer

Biology, 21.06.2019 20:00

After reading the paragraph below, answer the questions that follow. researchers have created a robot that has a very thin leg that is moved by cardiac (heart) cells contracting in unison. the robot, made of a polymer similar to that used in making contact lenses, is bathed in heart cells with supporting cells, which then attach to the robot and provide movement as they contract. all of the cardiac cells working together can cause the robot leg to move in a way that individual cells could not. this is an example of a. emergent properties of cells. b. energy flow through an ecosystem. c. adaptation. d. internal environment regulation.

Answers: 3

Answer

Biology, 22.06.2019 01:30

Scenario 5 1) take 10 red and 10 black beans and place them, mixed, on the table. record the starting phenotype # and frequencies (% of your total population) of your starting population in the table provided (generation 0). 2) act as a predator. â€ścaptureâ€ť as many organisms as you can until you have reduced the population to three organisms. put them aside. at this point, the predators die. 3) the remaining organisms each produce 2 clonal offspring. multiply your organisms accordingly and allow them to mix on the table. calculate and record the resultant phenotype # and frequencies (% of your total population) of your population in the table provided (generation 1). 4) repeat the reproduction event, allowing each of your organisms to produce 2 clonal offspring. calculate and record the resultant phenotype # and frequencies (% of your total population) of your population in the table provided (generation 2). 5) repeat the reproduction event, allowing each of your organisms to produce 2 clonal offspring. calculate and record the resultant phenotype # and frequencies (% of your total population) of your population in the table provided (generation 3).

Answers: 1

Answer

Biology, 22.06.2019 03:30

If assuming tasting ptc as a simple gene trait,what other genotype would you select to put in this missing genotype box that could result in this phenotype

Answers: 3

Answer

You know the right answer?

4. change any base (between the reading frame, excluding the start and stop codons) and show the cha...

Questions