Biology, 27.07.2019 01:00 gamboaserg
What is the relationship among chromosomes, genes, and dna? a. genes read the dna code found on chromosomes. chromosomes are long tightly wound strands of dna. b. genes are made up of tightly wound strands of dna. chromosomes are made up of one or more genes. c. genes are sections of dna and are found on chromosomes. chromosomes are long, tightly wound strands of dna. d. dna reads the nucleotide sequences found in genes. genes are located on tightly wound structures called chromosomes.
Answers: 1
Biology, 21.06.2019 23:40
Which statement describes an endocrine function rather than an exocrine function? a. salivary glands release saliva into the mouth. b. sweat glands release sweat onto the skin c. the pineal gland releases melatonin into the blood. d. esophageal glands release mucus into the esophagus.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
How would you expect the mrna codons that code for the amino acids that make up hemoglobin to compare between humans
Answers: 1
Biology, 22.06.2019 21:50
Acodon consists of bases and specifies which will be inserted into the polypeptide chain.
Answers: 2
What is the relationship among chromosomes, genes, and dna? a. genes read the dna code found on ch...
Computers and Technology, 09.10.2019 15:30
Chemistry, 09.10.2019 15:30
Health, 09.10.2019 15:30
History, 09.10.2019 15:30
Health, 09.10.2019 15:30
Mathematics, 09.10.2019 15:30
Biology, 09.10.2019 15:30
Biology, 09.10.2019 15:30