English, 07.11.2020 05:40 jlchandl

Information about Reuters content and services, please visit Reuters website at www. reuters. com What is the purpose of the following detail from the passage? "You cannot force people to read something they just do not care about." A. to show that it does not matter what a news story is about as long as it is world news OB. to demonstrate that all news stories do not reach their audience on a personal level Oc. to explain that a world news story needs to have a personal appeal to local people OD. to persuade the reader to find strange and silly world news stories that make no sense Reset Next

Answers: 3

Show answers

Another question on English

English, 21.06.2019 18:30

Which word in the passage the reader determine the meaning of the word miscarriage? toilattracteddicgraced

Answers: 1

Answer

English, 21.06.2019 23:30

What effect does an author achieve b the language of the monstrous? y using words with strong connotations? how does this relate to

Answers: 3

Answer

English, 22.06.2019 02:00

I’m robert frost poem “mending wall”, what does the narrator have on his side of the wall? a. a pine forest b. a cow farm c. an apple orchard d. a rabbit nursery

Answers: 2

Answer

English, 22.06.2019 06:30

Someone get back to me , i really don’t get this

Answers: 2

Answer

You know the right answer?

Information about Reuters content and services, please visit Reuters website at www. reuters. com Wh...

Questions

English, 15.04.2020 03:53

The main idea is usually found after the topic sentence. True False...

Mathematics, 15.04.2020 03:53

What is the approximate area of the figure ?...

Social Studies, 15.04.2020 03:54

Jane enters into a contract with Jill to provide 100 roses for a dinner party. Jill fails to deliver the roses. Jane initiates a suit against Jill, as...

Business, 15.04.2020 03:54

Suppose that when the price of wheat is $2 per bushel, farmers can sell 10 million bushels. When the price of wheat is $3 per bushel, farmers can sell...

Biology, 15.04.2020 03:54

Multicellular organisms evolved from three different ancestral lineages: stramenopiles, unikonts, and archaeplastids. Of these, fungi and animals evol...

Physics, 15.04.2020 03:54

The plates of a parallel-plate capacitor are 2.50 mm apart, and each carries a charge of magnitude 77.0 nC. The plates are in vacuum. The electric fie...

Business, 15.04.2020 03:54

Which of the following reasons for diversification is MOST likely to increase the firm's value? a. Increasing managerial compensation b....

Biology, 15.04.2020 03:54

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In...

Mathematics, 15.04.2020 03:54

A newly constructed fish pond contains 1000 liters of water. Unfortunately, the pond has been contaminated with 5 kg of a toxic chemical during the co...

Mathematics, 15.04.2020 03:54

1. Write the polynomial in standard form. Identify the degree and leading coefficient of the polynomial. $-3p^3+5p^6-4$ The polynomial i...

Mathematics, 15.04.2020 03:54

Mitch wants to buy a camera. The sale price is $291. What was the original price? 25% off original price....

Computers and Technology, 15.04.2020 03:54

We have the following functional dependencies: course_no, student_id -> grade course_no -> course_name We have the followin...

Physics, 15.04.2020 03:54

A man unloads a 4.0-kg box from a moving van by giving it an initial speed of 1.1 m/s down a ramp that makes an angle of 18° with the horizontal. It s...

Business, 15.04.2020 03:54

One reason new products fail is that although most major corporations use a formal decision-making process, sometimes they fail to critically evaluate...

Health, 15.04.2020 03:54

Max is a seven-month-old baby who was abandoned at an orphanage. He does not get enough nutrition and has not put on any weight in the last few months...

Business, 15.04.2020 03:54

A large retail organization previously divided work among its four employee-benefitsstaff into distinct specializations. One person answered all quest...

Mathematics, 15.04.2020 03:54

Engineers want to design seats in commercial aircraft so that they are wide enough to fit 99 % of all males. (Accommodating 100% of males would requir...

Medicine, 15.04.2020 03:54

Tuberculosis is a serious bacteria infection. If you become infected with tuberculosis you will?...

History, 15.04.2020 03:54

The image on the right shows Mary Vecchio reacting to a student who had been shot by antiwar protestors antiwar officials the...

Advanced Placement (AP), 15.04.2020 03:54

Imagine imagining things worthless to spend money on bro Free Points lol...

More questions: English Another questions