subject

Mathematics, 25.04.2020 02:08 jayowens20

Whoever is willing to help me out please do so. I will give points and brainliest. I have a headache so yeah..

Whoever is willing to help me out please do so. I will give points and brainliest. I have a headache

ansver

Answers: 1

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 12:30

(01.04 mc) an ice sculpture is melting because of heat. assuming its height changes bynegative 5 over 32m every hour, what will be the change in height after 4 hours?

Answers: 2

question

Mathematics, 21.06.2019 13:00

Ihave a 69 and an 82. the 69 is worth 40% of my grade and the 82 is worth 15%. can someone tell me my current average grade.

Answers: 1

question

Mathematics, 21.06.2019 17:30

One positive number is 9 more than twice another. if their product is 95, find the numbers

Answers: 1

question

Mathematics, 21.06.2019 21:30

Jonathan can type 20 documents in 40 minutes ,and susan can type it in 30 minutes and jack can type it in 24 minutes working together ,how much time will it is take them type the same document

Answers: 1

You know the right answer?

Whoever is willing to help me out please do so. I will give points and brainliest. I have a headache...

Questions

question

Mathematics, 01.04.2021 17:30

Geometry Questions s ...

question

Business, 01.04.2021 17:30

On December 31, 2015, Nolte Co. is in financial difficulty and cannot pay a note due that day. It is a $3,000,000 note with $300,000 accrued interest...

question

Biology, 01.04.2021 17:30

Many mammals whose diet includes a great deal of leafy plant matter have extra compartments or extensions of their digestive tract that are not presen...

question

Mathematics, 01.04.2021 17:30

ANSWER QUICK PLS Find m4 if m1 = 100°. a. 100° b. 80° c. 180° d. 90°

question

English, 01.04.2021 17:30

can some one help me with this not all the answers fit in this one so i'll post as many as i can and post the restin another one.

question

History, 01.04.2021 17:30

At the "first Thanksgiving," the Pilgrims famously feasted with the American Indians. Think about what you learned about Pilgrims, Puritans, and Ameri...

question

English, 01.04.2021 17:30

Which sentence best explains Lincoln's wartime decisions? BRANLIEST adapted from Lincoln the Great by Wilfred W. McClay We should r...

question

English, 01.04.2021 17:30

What Is the parallel structure and how do I find it?...

question

Business, 01.04.2021 17:30

The manufacturing overhead budget at Foshay Corporation is based on budgeted direct labor-hours. The direct labor budget indicates that 7,800 direct l...

question

English, 01.04.2021 17:30

For a company to develop an effective customer-centric culture, there is always room for:...

question

Mathematics, 01.04.2021 17:30

This math problem help me...

question

Biology, 01.04.2021 17:30

What is the complimentary strand for the DNA AACGGTCCAGTCCAAGTTACG?...

question

Chemistry, 01.04.2021 17:30

Which of the following statements are true regarding the remainder of the experiment if the scientist wants to use the combined gas law to calculate d...

question

Biology, 01.04.2021 17:30

Which scenario MOST LIKELY represents genetic drift and why? Question 2 options: Scenario 2, because the dark beetles are most fit for th...

question

Mathematics, 01.04.2021 17:30

Please help Lia brought 21 shirts and plants. Her total was $357. Pants cost $25 each, and shirts cost $14.50 each. How many of each item did she buy?...

question

Business, 01.04.2021 17:30

The McAllisters had several serious problems with their house, including leaks in the ceiling, a buckling wall, and dampness. They repaired the buckli...

question

Business, 01.04.2021 17:30

The goal of the review in a business presentation is to Multiple choice question. compel audience members to consider taking specific actions. lead au...

question

History, 01.04.2021 17:30

"If a thousand [citizens] were not to pay their tax-bills this year, that would not be a violent and bloody measure, as it would be to pay them, and e...

question

History, 01.04.2021 17:30

Which TWO of the following is a task carried out by the executive branch? Select two answers....

question

Mathematics, 01.04.2021 17:30

Solve for x please help ...

More questions: Mathematics Another questions

Questions on the website: 13722361