Mathematics, 02.03.2021 04:30 treseanthegreat

Find the distance between the points. Give
(-2, - 7) and ( - 4. - 11)

Answers: 3

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 23:30

Which of the following vectors are orthogonal to (2,1)? check all that apply

Answers: 1

Answer

Mathematics, 22.06.2019 00:00

What is the value of the product (3-2i)(3+2i)?

Answers: 2

Answer

Mathematics, 22.06.2019 00:30

Tyler reads 2/5 of a book on monday, 1/3 of it on tuesday, 2/9 of it on wednesday, and 3/4 of the remainder on thursday. if he still has 14 pages left to read on friday, how many pages are there in the book?

Answers: 3

Answer

Mathematics, 22.06.2019 03:00

∠1 and ∠2 are vertical angles. ∠2 has a measure of 63°. what is the measure of ∠1 ? enter your answer in the box.

Answers: 2

Answer

You know the right answer?

Find the distance between the points. Give
(-2, - 7) and ( - 4. - 11)...

Questions

Mathematics, 19.10.2020 08:01

To eliminate 6X you would Transform 2x by multiplying what number ?...

Mathematics, 19.10.2020 08:01

10) Two supplementary angles have measures of 3x - 20 and 5x. Find x. 11) Find the perimeter of a rectangle with side lengths of 14 inches and 18 inc...

Biology, 19.10.2020 08:01

Explain elementarycanal...

Mathematics, 19.10.2020 08:01

At an archeological site, the remains of two ancient step pyramids are congruent. If ABCD~=EFGH, find AD (Diagrams are not to scale) AD=...

Mathematics, 19.10.2020 08:01

ABCD is a parallelogram such that ∠A=(3x - 10)°, ∠C= (x + 80)°and ∠D = (y + 25)°. Find the values of x and y. ILL MARK ANYONE WHO GIVES...

Advanced Placement (AP), 19.10.2020 08:01

In the book behind closed doors. How does Jack plan to explain Millie and Grace's absence once he begins his torture?...

Mathematics, 19.10.2020 08:01

The sum of two numbers is seven. The sum of the squares of the two numbers is twenty-nine. Find the two numbers....

Mathematics, 19.10.2020 08:01

Please I need some answers ...

Mathematics, 19.10.2020 08:01

5) Which angle forms a linear pair with 7)Which angle forms a pair of vertical angles with

Arts, 19.10.2020 08:01

Where did the woman go if they were overwhelmed in Pompey’s Theatre?...

Mathematics, 19.10.2020 08:01

Write an equation of the parabola that passes throigh the points (-2,7), (1,10), and (2,27)...

Mathematics, 19.10.2020 08:01

Solve for x, picture below 30-60-90 triangle ...

Biology, 19.10.2020 08:01

On a corpse, there are beetles and mites, but no flies, ants, or larvae. Which is the correct postmortem interval? 8 days 4 days 1...

Mathematics, 19.10.2020 08:01

Yahtzee is a classic dice game played with 5 dice. Each player's turn consists of rolling the dice up to 3 times in hope of making 1 of 13 categorie...

History, 19.10.2020 08:01

Question 3: What was the importance of international economics (trade and commerce) on the emergence of the colonies in the Americas. Be sure to expla...

Physics, 19.10.2020 08:01

Give two important reasons to do a rough sketch of the crime scene?...

Mathematics, 19.10.2020 08:01

14) Which of the following correctly shows the markings for a perpendicular bisector?

Biology, 19.10.2020 08:01

Hep pl In an mRNA sequence in the following order:CGUAUGGGCUUACUAGUCUAACA: What is the first anticodon to enter the P position?B. W...

Physics, 19.10.2020 09:01

Are the most efficient detector of light...

Mathematics, 19.10.2020 09:01

4+7x=-10+5x please answer...

More questions: Mathematics Another questions

Find the distance between the points. Give (-2, - 7) and ( - 4. - 11)

Answers

Another question on Mathematics

Find the distance between the points. Give
(-2, - 7) and ( - 4. - 11)