Mathematics, 10.03.2021 14:00 Ashtree519

What equation represents a line in point slope form that has a slope of 5 and passes the point 1,6

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 15:30

Diane owes $387 to her brother. if she debits her bank account $161.25 a month to pay him back, how many months will it take her to pay off the debt?

Answers: 2

Answer

Mathematics, 21.06.2019 20:30

Two triangles can be formed with the given information. use the law of sines to solve the triangles. b = 49°, a = 16, b = 14

Answers: 3

Answer

Mathematics, 21.06.2019 21:30

Ten members of balin's soccer team ran warm ups for practice. each member ran the same distance. their combined distance was 5/6 of a mile. to find the distance that each member ran, balin wrote the expression below.

Answers: 3

Answer

Mathematics, 21.06.2019 21:40

Drag the tiles to the correct boxes to complete the pairs. label each function. as even , odd, or neither.

Answers: 1

Answer

You know the right answer?

What equation represents a line in point slope form that has a slope of 5 and passes the point 1,6...

Questions

English, 05.11.2020 18:40

The main idea of paragraph 11 is that... a. it is very easy to go to heaven and no one should miss the opportunity. b. heaven is full of...

Business, 05.11.2020 18:40

Marple Company's budgeted production in units and budgeted raw materials purchases over the next three months are given below: January February March...

History, 05.11.2020 18:40

Who was the 12th president of the USA...

Mathematics, 05.11.2020 18:40

Solve 3x + y = 1 for y*...

English, 05.11.2020 18:40

Which element of "Mary's Flag" is developed more fully in "A Dramatic Flag"? A. the role of Philadelphia in the establishment of a new governme...

Mathematics, 05.11.2020 18:40

How many solutions are there to the equation below? x=-64 A. -8 B. O c. 8 D. 16 E. 2

Business, 05.11.2020 18:40

Jeremy's level of satisfaction from consuming the first cookie was 25 utils. The second cookie increased the level of satisfaction by 20 utils. Jeremy...

English, 05.11.2020 18:40

She told fellow scientists and friends that “knowing what I do, I have no choice but to set it down to be read.” Select ALL the conclusions about Cars...

Physics, 05.11.2020 18:40

A 10 kg object is subjected to two forces F1 and F2. F1 has a magnitude of 20 N and acts straight upward and F2 has a magnitude of 30 N at 30 degrees...

Biology, 05.11.2020 18:40

Below is a partial mRNA sequence. Use it to answer the following questions. 5' - UGGUCGGCGAGAACGAAAGCGC - 3' Encoded within the partial mRNA s...

Biology, 05.11.2020 18:40

How do acacia trees communicate with each other in response to insect attack? A) They produce a gas called ethylene. B) They release pollen.

Mathematics, 05.11.2020 18:40

I need help with these too ...

Mathematics, 05.11.2020 18:40

Drag and drop the expressions into the boxes to correctly complete the proof of the polynomial identity.(x^2-y^2)^2+x^4+y^4=2(x^4- x^2y^2y^4)...

Physics, 05.11.2020 18:40

Cfare nxitimi shkakton forca F=40N, qe vepron neme mase m=10kg??...

Mathematics, 05.11.2020 18:40

Use approximation to find the square root to the nearest hundredth. 131...

Mathematics, 05.11.2020 18:40

Please help and add steps i’m stuck :( ...

Business, 05.11.2020 18:40

Savvy Sightseeing had beginning equity of $72,000; revenues of $90,000, expenses of $65,000, and dividends to stockholders of $9,000. There were no st...

Chemistry, 05.11.2020 18:40

“What ion does Magnesium (Mg) become?” A. Mg1- B. Mg2- C. Mg1+ D. Mg2+...

Business, 05.11.2020 18:40

On October 1, 2020, PNC Bank lends Peter's Landscaping, Inc. $50,000 for 6- months with an APR of 8%. What is the amount of interest earned for 2020 b...

Chemistry, 05.11.2020 18:40

A chemistry student needs 55.0g of carbon tetrachloride for an experiment. by consulting the crc handbook of chemistry and physics, the student discov...

More questions: Mathematics Another questions