Mathematics, 26.05.2021 20:20 lisbet123085

What are the zeroes of this
y= 2x2 -12x +16

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 20:10

Complete the solution of the equation. find the value of y when x equals -5. -4x - 8y = -52

Answers: 2

Answer

Mathematics, 21.06.2019 20:30

Hi if you want to play a sports related kahoot go to kahoot.it and type in this code: 659344

Answers: 1

Answer

Mathematics, 21.06.2019 21:20

Which of the following can be used to explain a statement in a geometric proof?

Answers: 2

Answer

Mathematics, 21.06.2019 23:30

Harry the hook has 7 1/3 pounds of cookie dough.she uses 3/5 of it to bake cookie. how much cookie dough does she use to make cookie?

Answers: 1

Answer

You know the right answer?

What are the zeroes of this
y= 2x2 -12x +16...

Questions

Biology, 19.10.2020 08:01

Explain elementarycanal...

Mathematics, 19.10.2020 08:01

At an archeological site, the remains of two ancient step pyramids are congruent. If ABCD~=EFGH, find AD (Diagrams are not to scale) AD=...

Mathematics, 19.10.2020 08:01

ABCD is a parallelogram such that ∠A=(3x - 10)°, ∠C= (x + 80)°and ∠D = (y + 25)°. Find the values of x and y. ILL MARK ANYONE WHO GIVES...

Advanced Placement (AP), 19.10.2020 08:01

In the book behind closed doors. How does Jack plan to explain Millie and Grace's absence once he begins his torture?...

Mathematics, 19.10.2020 08:01

The sum of two numbers is seven. The sum of the squares of the two numbers is twenty-nine. Find the two numbers....

Mathematics, 19.10.2020 08:01

Please I need some answers ...

Mathematics, 19.10.2020 08:01

5) Which angle forms a linear pair with 7)Which angle forms a pair of vertical angles with

Arts, 19.10.2020 08:01

Where did the woman go if they were overwhelmed in Pompey’s Theatre?...

Mathematics, 19.10.2020 08:01

Write an equation of the parabola that passes throigh the points (-2,7), (1,10), and (2,27)...

Mathematics, 19.10.2020 08:01

Solve for x, picture below 30-60-90 triangle ...

Biology, 19.10.2020 08:01

On a corpse, there are beetles and mites, but no flies, ants, or larvae. Which is the correct postmortem interval? 8 days 4 days 1...

Mathematics, 19.10.2020 08:01

Yahtzee is a classic dice game played with 5 dice. Each player's turn consists of rolling the dice up to 3 times in hope of making 1 of 13 categorie...

History, 19.10.2020 08:01

Question 3: What was the importance of international economics (trade and commerce) on the emergence of the colonies in the Americas. Be sure to expla...

Physics, 19.10.2020 08:01

Give two important reasons to do a rough sketch of the crime scene?...

Mathematics, 19.10.2020 08:01

14) Which of the following correctly shows the markings for a perpendicular bisector?

Biology, 19.10.2020 08:01

Hep pl In an mRNA sequence in the following order:CGUAUGGGCUUACUAGUCUAACA: What is the first anticodon to enter the P position?B. W...

Physics, 19.10.2020 09:01

Are the most efficient detector of light...

Mathematics, 19.10.2020 09:01

4+7x=-10+5x please answer...

Mathematics, 19.10.2020 09:01

PLEASE HELP ASAP!Reasoning The numbers 1.333... and 1.444... are both rational numbers. Which of the following is an irrational number that is betwee...

Mathematics, 19.10.2020 09:01

Write an expression to represent the area of the rectangle below in simplest form.

More questions: Mathematics Another questions

What are the zeroes of this y= 2x2 -12x +16

Answers

Another question on Mathematics

What are the zeroes of this
y= 2x2 -12x +16