This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place. ATTTGCATACTACCGGGC

The red letters are the noncoding region, and the black letters are the protein coding region.

ATTAGCATACTACGGGC
ATTTGCATACTGACCGGGC
ATTTGCAATACTACCGGGC
ATTTGCAACTACCGGGC
ATGAATGCATACTACCGGGC

La olla es de metal por que se calienta mas rápido, y las manijas son de madera por que así no se calientas y tienden a estar mas frías.

The figure is missing but we can answer anyway.the correct answer is "releasing the string". in fact, when the person is holding the bow and the arrow, the kinetic energy of the arrow is still zero (because the arrow is not moving). the moment the arrow is released, it acquires a velocity v, so its kinetic energy will become different from zero: where m is the mass of the arrow and v its velocity.  all the other options, instead, do not increase the kinetic energy of the system: -  pulling farther back on the string : this will just increase the elastic potential energy of the system-  holding the arrow higher: this will increase the gravitational potential energy of the system (which is given by u=mgh, where h is the height above the ground)-  decreasing the mass of the arrow: this will decrease the gravitational potential energy of the system (which is given by u=mgh, where m is the mass)