subject

Social Studies, 20.11.2019 14:31 ayoismeisalex

24 !
what kind of desert is the gobi?
a. the gobi is a rain shadow desert formed formed by the himalaya range blocking rain-carrying clouds from reaching the gobi.
b. the climate is arid
c. the region is hot and sandy

ansver

Answers: 1

Show answers

Another question on Social Studies

question

Social Studies, 22.06.2019 06:30

What was the main motivation for the early populists

Answers: 3

question

Social Studies, 22.06.2019 12:30

Which of the following policies can the government use to encourage entrepreneurship?

Answers: 2

question

Social Studies, 22.06.2019 18:30

In which type of economy are these decisions made by the producers , consumers, and the goverment?

Answers: 2

question

Social Studies, 22.06.2019 19:30

Which of the following would a historian most likely study to find data

Answers: 1

You know the right answer?

24 !
what kind of desert is the gobi?
a. the gobi is a rain shadow desert formed form...

Questions

question

History, 05.11.2020 18:40

Complete each sentence or statement. The city of became the city of New York....

question

English, 05.11.2020 18:40

Will give brainliest Read the following excerpt from "Ellis Island" by Barbara Davis-Pyle. Then I smiled because all of the questions were over. The...

question

Spanish, 05.11.2020 18:40

Observa y escribe. Look at the picture and describe what you see and its location.

question

Mathematics, 05.11.2020 18:40

What number is 3 units to the right of 2 on the number line? A number line from negative seven to seven is shown. A point is plotted at two....

question

Mathematics, 05.11.2020 18:40

Kenny is practicing for a typing test to obtain a job as a paralegal. The number of words he can type is proportional to the number of minutes. If the...

question

English, 05.11.2020 18:40

The main idea of paragraph 11 is that... a. it is very easy to go to heaven and no one should miss the opportunity. b. heaven is full of...

question

Business, 05.11.2020 18:40

Marple Company's budgeted production in units and budgeted raw materials purchases over the next three months are given below: January February March...

question

History, 05.11.2020 18:40

Who was the 12th president of the USA...

question

Mathematics, 05.11.2020 18:40

Solve 3x + y = 1 for y*...

question

English, 05.11.2020 18:40

Which element of "Mary's Flag" is developed more fully in "A Dramatic Flag"? A. the role of Philadelphia in the establishment of a new governme...

question

Mathematics, 05.11.2020 18:40

How many solutions are there to the equation below? x=-64 A. -8 B. O c. 8 D. 16 E. 2

question

Business, 05.11.2020 18:40

Jeremy's level of satisfaction from consuming the first cookie was 25 utils. The second cookie increased the level of satisfaction by 20 utils. Jeremy...

question

English, 05.11.2020 18:40

She told fellow scientists and friends that “knowing what I do, I have no choice but to set it down to be read.” Select ALL the conclusions about Cars...

question

Physics, 05.11.2020 18:40

A 10 kg object is subjected to two forces F1 and F2. F1 has a magnitude of 20 N and acts straight upward and F2 has a magnitude of 30 N at 30 degrees...

question

Biology, 05.11.2020 18:40

Below is a partial mRNA sequence. Use it to answer the following questions. 5' - UGGUCGGCGAGAACGAAAGCGC - 3' Encoded within the partial mRNA s...

question

Biology, 05.11.2020 18:40

How do acacia trees communicate with each other in response to insect attack? A) They produce a gas called ethylene. B) They release pollen.

question

Mathematics, 05.11.2020 18:40

I need help with these too ...

question

Mathematics, 05.11.2020 18:40

Drag and drop the expressions into the boxes to correctly complete the proof of the polynomial identity.(x^2-y^2)^2+x^4+y^4=2(x^4- x^2y^2y^4)...

question

Physics, 05.11.2020 18:40

Cfare nxitimi shkakton forca F=40N, qe vepron neme mase m=10kg??...

question

Mathematics, 05.11.2020 18:40

Use approximation to find the square root to the nearest hundredth. 131...

More questions: Social Studies Another questions

Questions on the website: 13722363