This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place. ATTTGCATACTACCGGGC The red letters are the noncoding region, and the black letters are the protein coding region. ATTAGCATACTACGGGC ATTTGCATACTGACCGGGC ATTTGCAATACTACCGGGC ATTTGCAACTACCGGGC ATGAATGCATACTACCGGGC

In a paragraph, make a claim about the advantages of entrepreneurship and free enterprise. be sure to support your claim with reasons and evidence. also, address at least one counterclaim in your answerthe ability of entrepreneurs to exist and thrive is the largest advantage of free enterprise. while some might say that entrepreneurship can create unemployment, entrepreneurs and free enterprise actually provide benefits. these positive outcomes include creating income, reducing unemployment, and providing funding for the government through taxes.

Should domestic security cases be handled differently than other types crimes?

((ᵔᴥᵔ)}[ select all that apply questions! ]{(ᵔᴥᵔ)(1.) which of the following causes of the french government's financial crisis spark the revolution? select all that apply.a.the extravagant spending by the courtb. the cost of the seven years' warc. the expenses of running the bastilled. the cost of aid given to finance the american revolution(2.) despite naming himself emperor, why was napoleon pivotal as a french revolutionary? select all that apply.a. he fostered revolts during his reign.b. he frightened the monarchs of europe with the idea of representative governments.c. he established democracies throughout his empire.d. he established republics that embodied the ideas of the revolution.e. his declaration fueled the ire of the revolutionaries to rise up against him.(｡◕‿‿◕｡)