subject
Arts, 26.11.2020 05:40 jojosiwa6

Im bored so what is this song? daylight is fading away, night silhouettes in the sky,
LED lights are flashing on towers, It's Manhattan's magical time
Ballerinas dancing the Swan Lake
On a river made of diamonds and pearls
Everything's a little bit weird now.

ansver
Answers: 2
Show answers

Another question on Arts

question
Arts, 23.06.2019 08:30
Abelief about the attributes of members of a group of people is called?
Answers: 3
Answer
question
Arts, 24.06.2019 00:00
In three to five sentences, list and briefly explain the three elements of music
Answers: 1
Answer
question
Arts, 24.06.2019 08:30
Discuss the political message found in honoré daumier’s rue transnonian and explain how it relates to realism
Answers: 1
Answer
question
Arts, 24.06.2019 17:00
Identify the tense . you will find that book on the very top shelf.
Answers: 1
Answer
You know the right answer?
Im bored so what is this song? daylight is fading away, night silhouettes in the sky,
LED lig...
Questions
question
Mathematics, 14.04.2021 23:40
CosB = 13/33 for which of the following triangles?
question
Chemistry, 14.04.2021 23:40
If an astronaut weighs 79 kilograms (175 pounds) and his space suit weighs 50 kilograms (110 pounds), how much would the astronaut and his suit weigh...
question
Biology, 14.04.2021 23:40
What is the complementary DNA of TACCGGATGCCAGATCAAATC?...
question
Mathematics, 14.04.2021 23:40
A cone has a radius of 3 feet and a height of 2 feet. How many cones of liquid would it take to fill a cylinder with a diameter of 6 feet and a height...
question
Mathematics, 14.04.2021 23:40
If the magnitude of vector U is ||u|| ≈ 7.81 and its angle of direction is 129.81°, which graph represents vector -u?
question
Mathematics, 14.04.2021 23:40
Water is being drained from a swimming pool containing 12,000 gallons of water. After one hour passes, 60% of the water remains. At the start of the...
question
Mathematics, 14.04.2021 23:40
¿Cuántos factores iguales tiene la potencia 0 elevado a 2 y 0 elevado a 5? ¿ Y cómo podemos generalizar la situación?...
question
Mathematics, 14.04.2021 23:40
A round clock has a radius of 5 cm. What is the approximate area of the clock? Use 3.14 for pi. 0 31.4 square centimeters 314 square cent...
question
Mathematics, 14.04.2021 23:40
George goes to the pool store with his father to get chlorine. Each jug weighs 7.8 pounds. If they get 10 jugs, how much does all the chlorine weigh?...
question
Health, 14.04.2021 23:40
Steal the Flag Rules: Question 1 You can get out on your own side if your flag gets pulled while holding the ball. True or false...
question
Social Studies, 14.04.2021 23:40
Follow Jaysuels on twitch...
question
History, 14.04.2021 23:40
Germany’s invasion of which country started World War II? Great Britain the Soviet Union France Poland...
question
Chemistry, 14.04.2021 23:40
Which of the following galaxies do not have a regular structure? A. Elliptical and barred spiral galaxies B. Irregular and elliptical galaxies...
question
Chemistry, 14.04.2021 23:40
Hexane is non-polar. Which of the following compounds will it dissolve? a. Propane, non-polar b. Magnesium chloride, polar...
question
English, 14.04.2021 23:40
The part of speech helps determine ~how to use a word ~the job of the word in a sentence ~what the author meant ~the purpose of t...
question
Mathematics, 14.04.2021 23:40
Plzzz help I need help so bad ...
question
Medicine, 14.04.2021 23:40
What is the measurement scale for years?...
question
Mathematics, 14.04.2021 23:40
Which of the following segments is not congruent to the others? A. FJB. JBC. BM​
question
English, 14.04.2021 23:40
PL HELP DONT TAKE POINTS 70 POINTS ILL SEND 50 IF U HELP PL HELP think of a person who has caused a positive impact (role model) in your life and for...
question
History, 14.04.2021 23:40
3. Who were the two chief advisers to the King at this time? a. Richelieu and Mazarin b. Mazarin and Henry C. Richelieu and Henry d...
More questions: Arts Another questions
Questions on the website: 13722362
See results (0)