What is the complementary DNA of TACCGGATGCCAGATCAAATC?

1. watermelon, papaya, oranges, bananas, and lemons are included in this food group. vitamin c 2. you need 6 or more servings of this food group each day vitamins d and a 3. found in fruit and keeps blood vessels healthy calcium 4. vitamins found in milk bread and grain 5. a mineral that strengthens bones fruit

In pea plants, the allele for inflated pod seed, i, is dominant over the allele for constricted pod seed, i. the punnett square shows a cross for this trait. which offspring will be homozygous dominant

Veins have a much lower blood pressure than arteries. which of these prevents backflow of blood in veins? a. pressure applied by the heart b. one–way valves in veins c. thin muscular walls of veins