subject
Biology, 17.11.2019 13:31 cassmoney94

An organism that contains two of the same alleles for a trait is said to be for that trait.. a. heterozygous. b. homozygous. c. recessive. d. dominant

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 01:00
Which statement describes john tuzo wilson’s contribution to the theory of plate tectonics?
Answers: 3
question
Biology, 22.06.2019 05:30
Food webs - transferring energy and matter from one level to another. here you see four food webs. one or more are incorrect. which food web(s) show the correct sequence of organisms, from start to top level consumer? a) a b) d c) c d) a and d
Answers: 2
question
Biology, 22.06.2019 11:30
Which of the following does not make up ground substance of connective tissue? hyaluronic acid elastic fibers glycosaminoglycan proteoglycan
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
An organism that contains two of the same alleles for a trait is said to be for that trait.. a. het...
Questions
question
Mathematics, 18.03.2020 21:41
question
English, 18.03.2020 21:41
Questions on the website: 13722367