Answers: 2
Biology, 22.06.2019 08:20
The table lists the observations students made about four specimens under a microscope. based on these observations, what specimens did the students examine? animal plant virus prokaryote cell membrane present ribosomes present lysosomes present nuclear membrane present cell wall present ribosomes present nuclear membrane absent cell wall present ribosomes present nucleus present large vacuole present reproduces inside of a cell nucleus absent rna present 2019 edmentum all rights reserved intl
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 16:20
Which example best describes a reflex action? a. eating food when hungry b. coughing when the throat is irritated c. bending down to lift a heavy object d. going for a walk outside
Answers: 2
Biology, 22.06.2019 23:20
Match each term to its scientific definition. a)natural world b)scientific method c)theory 1) everything that can be observed or explained scientifically 2) a well-supported explanation of all the evidence related to a natural phenomenon 3) the procedure of scientific inquiry used to investigate natural phenomena
Answers: 2
In which of the four biomes marked on this map would you expect to find points adapted for seasonal...
Mathematics, 02.03.2020 23:30
Computers and Technology, 02.03.2020 23:31